View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15435_low_12 (Length: 222)
Name: NF15435_low_12
Description: NF15435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15435_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 12 - 106
Target Start/End: Complemental strand, 8751873 - 8751779
Alignment:
| Q |
12 |
aagcaaaggtgatctatcaaatcgtcacaactacatcatacagtatgtatataagccctttaactactacaccagcgtataaaccatgtgcaagc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8751873 |
aagcaaaggtgatctatcaaatcgtcacaactacatcatacagtatgtatataagccctttaactactacaccagcgtataaaccatgtgcaagc |
8751779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 207
Target Start/End: Complemental strand, 8751743 - 8751665
Alignment:
| Q |
129 |
gcatggcatatacgttactttatttatcaaaatcttttgtttcgtagtttaaggactgagagagaaaatagtataaact |
207 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8751743 |
gcatgacatatacgttactttatttatcaaaatcttttgtttcgtagcttaaggactgagagagaaaatagtataaact |
8751665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University