View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15436_low_6 (Length: 279)
Name: NF15436_low_6
Description: NF15436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15436_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 21 - 265
Target Start/End: Complemental strand, 30576185 - 30575941
Alignment:
| Q |
21 |
ctccttcctctgtattatctcccgtcgatattatggaagaaaccaaccactacgacaacaaagtcattcattctcggcaagcacagattcggaccagatc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576185 |
ctccttcctctgtattatctcccgtcgatattatggaagaaaccaaccactacgacaacaaagtcattcattctcggcaagcacagattcggaccagatc |
30576086 |
T |
|
| Q |
121 |
tgtatgtcgtggttgggaaagtttttcctttcatatgactctatcaaaaatgtacaatgtggttgaactttctgctcttggaattggtagttgtttttgc |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576085 |
tgtatgtcgcagttgggaaagtttttcctttcatatggctctatcaaaaatgtacaatgcggttgaactttctgctcttggaattggtagttgtttttgc |
30575986 |
T |
|
| Q |
221 |
tcaacatttatatgaatttcaggtatatttttcactcgattgctc |
265 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30575985 |
tcaacatttttatgaatttcaggtatatttttcactcgattgctc |
30575941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University