View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15437_high_6 (Length: 318)
Name: NF15437_high_6
Description: NF15437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15437_high_6 |
 | |
|
| [»] scaffold0728 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0728 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0728
Description:
Target: scaffold0728; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 31 - 288
Target Start/End: Original strand, 5389 - 5646
Alignment:
| Q |
31 |
tcaacatatgttatcgccttcaaatactaatatgctgtctcccaagaatgaagagcatcgtcttctacaagcttcatttggtgtcccttcatgcggtagt |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
5389 |
tcaacatatgttatcgccttcaaatattaatatgctgtctcccaagaatgatgagcatcgtcttttacaagcttcatttagtgtcccttcatgcggtagc |
5488 |
T |
|
| Q |
131 |
atgtcacctagaaggcttgaaccaatctccccactgatccctcaaatgtccacatttcctcatcgcgagaaacagcagcaacagctgcagagtgttagtt |
230 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||| || |||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
5489 |
atgtcacctagaaggcttgaacaaatctccccactgagccctcaaatgtctgcacttcctcatcgcgagaaacagcagcaacaactgcagagtgttagct |
5588 |
T |
|
| Q |
231 |
ctagggaacttggttccaaaatcccttccccagttgttggatcacctgcggacccatg |
288 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
5589 |
ctagggaacttggttacaaaatcccttcctcagttgttggatcacctacggacccatg |
5646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 31 - 288
Target Start/End: Original strand, 19409823 - 19410080
Alignment:
| Q |
31 |
tcaacatatgttatcgccttcaaatactaatatgctgtctcccaagaatgaagagcatcgtcttctacaagcttcatttggtgtcccttcatgcggtagt |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
19409823 |
tcaacatatgttatcgccttcaaatattaatatgctgtctcccaagaatgatgagcatcgtcttttacaagcttcatttagtgtcccttcatgcggtagc |
19409922 |
T |
|
| Q |
131 |
atgtcacctagaaggcttgaaccaatctccccactgatccctcaaatgtccacatttcctcatcgcgagaaacagcagcaacagctgcagagtgttagtt |
230 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||| || |||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
19409923 |
atgtcacctagaaggcttgaacaaatctccccactgagccctcaaatgtctgcacttcctcatcgcgagaaacagcagcaacaactgcagagtgttagct |
19410022 |
T |
|
| Q |
231 |
ctagggaacttggttccaaaatcccttccccagttgttggatcacctgcggacccatg |
288 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
19410023 |
ctagggaacttggttacaaaatcccttcctcagttgttggatcacctacggacccatg |
19410080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University