View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15438_low_11 (Length: 301)
Name: NF15438_low_11
Description: NF15438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15438_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 284
Target Start/End: Complemental strand, 36352551 - 36352279
Alignment:
| Q |
13 |
aagaacaacaagaagaagtgatatcaagatactgttcaaggaatctttactataaatannnnnnnnnnaatgttttctagctattagcattatatattat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36352551 |
aagaacaacaagaagaagtgatatcaagatactgttcaaggaatctttactataaatattttttttttaatgttttctagctattagcattatatattat |
36352452 |
T |
 |
| Q |
113 |
aatatgtttatcttatctatcagcaggtttcagaaaatcagatatggttttattaatagccctctatttctatgtgtatgtctgatgacaagttgtttag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36352451 |
aatatgtttatcttatctatcagcaggtttcagaaaatcagatatggttttattaatagccctctatttctatgtgtatgtctgatgacaagttgtttag |
36352352 |
T |
 |
| Q |
213 |
tg-tttgtgacttatactctaatttattataattcttatattattgtacgatgatatgagttagctgttgatc |
284 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36352351 |
tgttttgtgacttatactctaatttattataattcttatattattatacgatgatatgagttagctgttgatc |
36352279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University