View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15438_low_14 (Length: 270)
Name: NF15438_low_14
Description: NF15438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15438_low_14 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 213 - 270
Target Start/End: Original strand, 48129368 - 48129425
Alignment:
| Q |
213 |
gggggttgaagaggaaagcaaacatatagttaagtatttgaaaattgtaggtctccca |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48129368 |
gggggttgaagaggaaagcaaacatatagttaagtatttgaaaattgtaggtctccca |
48129425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 48129200 - 48129248
Alignment:
| Q |
43 |
gagggaagatcaaactgcataatgtaattcaaacaaatttattcacgtag |
92 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48129200 |
gagggaagatcac-ctgcataatgtaattcaaacaaatttattcacgtag |
48129248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University