View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15438_low_15 (Length: 259)
Name: NF15438_low_15
Description: NF15438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15438_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 118 - 239
Target Start/End: Original strand, 9388348 - 9388469
Alignment:
| Q |
118 |
ttgatgtctagcatatatcttttcttaatgaggaaaactaagcattctatttgtgacacttattcaggttcatacaatgtttctttatccttgtcaacat |
217 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9388348 |
ttgatgtctagcatatctcttttgttaatgaggaaaactaagcattctatttgtgacacttattcaggttcatgcaatgtttctttatccttgtcaacat |
9388447 |
T |
|
| Q |
218 |
caaagagaataactctttttct |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9388448 |
caaagagaataactctttttct |
9388469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 9388239 - 9388294
Alignment:
| Q |
9 |
gacatcatcacatctttgcttgttttagcagttctcatattaatacaacttatacg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9388239 |
gacatcatcacatctttgcttgttttagcagttctcatattaatacaacttatacg |
9388294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University