View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15439_low_16 (Length: 379)
Name: NF15439_low_16
Description: NF15439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15439_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 252
Target Start/End: Complemental strand, 43070396 - 43070153
Alignment:
| Q |
9 |
atcttcacccctttgcgatttttcttccacttctccctgtgtagctaatttgatttttatttatttaacgttgctagtttattttgattaggctaggaag |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43070396 |
atcttcacccctttacgatttttcttccacttctccttgtgtagctaatttgatttttatttatttaacgttgctagtttattttgattaggctaggaag |
43070297 |
T |
 |
| Q |
109 |
gatatatatgaactctctaaaatcctgatgtaatgtgaacaattcttattcaatacatgtttataatcacatggtgactatcgtcccttcctcccaatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43070296 |
gatatatatgaactctctaaaatcctgatgtaatgtgaacaattcttattcaatacatgtttataatcacatggtgactatcgtcccttcctcccaatat |
43070197 |
T |
 |
| Q |
209 |
atataatttattttaacaaatgatgtacacaagagttaacatat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43070196 |
atataatttattttaacaaatgatgtacacaagagttaacatat |
43070153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 291 - 378
Target Start/End: Complemental strand, 43069647 - 43069568
Alignment:
| Q |
291 |
tgatggcataaactagcttacgaacgagttttatatatgccggaggtgcatgcaggattcaaccagtgtgctacttccttttccttct |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43069647 |
tgatggcataaactagcttacgaacgagttttat----gccggaggtgca----ggattcaaccagtgtgctacttccttttccttct |
43069568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University