View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15441_low_5 (Length: 220)
Name: NF15441_low_5
Description: NF15441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15441_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 303750 - 303927
Alignment:
| Q |
1 |
accattccaaactccatgccctaatagaaaccgttatgtgttttgggatgcatttcatccaacagaagcagttaacattcttatgggaaggatggctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303750 |
accattccaaactccatgccctaatagaaaccgttatgtgttttgggatgcatttcatccaacagaagcagttaacattcttatgggaaggatggctttt |
303849 |
T |
 |
| Q |
101 |
aatggcaataccaattttgtttatcctatcaacattcaccaacttgctcaactataataatatttcaactcttttatg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
303850 |
aatggcaataccaattttgtttatcctatcaacattcaccaacttgctcaactataataatatttcaactcttctatg |
303927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 303968 - 304011
Alignment:
| Q |
177 |
tggtgtattgcttcctagcttgatttccaattaaaattgtcata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303968 |
tggtgtattgcttcctagcttgatttccaattaaaattgtcata |
304011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University