View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15442_high_16 (Length: 246)
Name: NF15442_high_16
Description: NF15442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15442_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 31038953 - 31038730
Alignment:
| Q |
7 |
ggtcacaaccataaggacgtggaggatcttaaacttctacttaattaaatgtgacgatgatcatttgttgtcgaaattttaaacgagtttcaaatgtcgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31038953 |
ggtcacaaccataaggacgtggaggatcttaaacttctacttaattaaatgtgacgatgatcatttgttgtcgaaattttaaacgagtttcaaatgtcgg |
31038854 |
T |
|
| Q |
107 |
tcaactttagactttgtggaacacttttcccactcaagctgttgccttgctccaaatttaccagtttgtcgtgtagatcattgctgctacgagactgcaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31038853 |
tcaactttagactttgtggaacacttttcccactcaagctgttgccttgctgcaaatttaccagtttgtcgtgtagatcattgctgctacgagactgcaa |
31038754 |
T |
|
| Q |
207 |
ctcacccgctggctgagttcaagg |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31038753 |
ctcacccgctggctgagttcaagg |
31038730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University