View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15442_high_17 (Length: 239)
Name: NF15442_high_17
Description: NF15442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15442_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 4 - 132
Target Start/End: Original strand, 2024013 - 2024141
Alignment:
| Q |
4 |
ttgaaactttgcagaagcatccactaaagatcaaaacgacacaggagcaacatattcatgctgaaactttcaagaaaaattgcagcacaaacctgccaaa |
103 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2024013 |
ttgaaactttgcagaagcaccaactaaagatcaaaacaacacaggagcaacatattcatgctgaaactttcaagaaaaattgcagcacaaacctgccaaa |
2024112 |
T |
 |
| Q |
104 |
ttatgcacagcagcgaacaaaaaacaaca |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2024113 |
ttatgcacagcagcgaacaaaaaacaaca |
2024141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 14194790 - 14194749
Alignment:
| Q |
161 |
attattaattgaggtgacactaatgtccattttgcatccttg |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14194790 |
attattaattaaggtgacactaatgtccattttgcatccttg |
14194749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University