View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15442_low_25 (Length: 225)
Name: NF15442_low_25
Description: NF15442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15442_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 47997364 - 47997160
Alignment:
| Q |
1 |
tggtttagtgagtgattaccaactgctacgtgaaaaaccacttttgttttaagtaattgacgtttaacattaagttatgatctaacagtaaaaagaaaaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47997364 |
tggtttagtgagtaattaccaactgctacgtgaaaaaccacttttgttttaagtaattgacgtttaacattaagttatgatctaacagtaaaaagaaaaa |
47997265 |
T |
|
| Q |
101 |
ccattgttgtgactggtgaggcgcatataatgaaacatttggtgttggaacttggaatattggactaaaatagagaaatactatcaacaacaatgtcaaa |
200 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47997264 |
ccattgttatgaccggtgaggcgcatataatgaaacatttggtgttggaacttggaatattgaactaaaatagagaaataatatcaacaacaatgtcaaa |
47997165 |
T |
|
| Q |
201 |
cacat |
205 |
Q |
| |
|
||||| |
|
|
| T |
47997164 |
cacat |
47997160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University