View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15443_high_5 (Length: 313)
Name: NF15443_high_5
Description: NF15443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15443_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 271
Target Start/End: Original strand, 33479042 - 33479305
Alignment:
| Q |
8 |
agaacctgtgcttgaactcgagcattagtaaaaatgtaagttggggttgatagctttagaaaaggtgagttttcatgtccacacgacaaaaataaggagg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33479042 |
agaacttgtgcttgaactcgagcattagtaaaaatgtaagttggggttgatagctttagaaaaggtgagttttcatgtccacataacaaaaataaggagg |
33479141 |
T |
|
| Q |
108 |
ggaattgaatttgaacctgatgtcttatatctcttaacccgtaatctgcttcaacaatatcatcaagcgaccttatttataattgaagttatatagatag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33479142 |
ggaattgaatttgaacctgatgtcttatatctcttaacccgtaatctgcttcaacaatatcatcaaacgaccttatttataattgaagttatatagatag |
33479241 |
T |
|
| Q |
208 |
atatacagtcttatatacaattatatctagagttctttaacttaatttaaagctttaaacaaag |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33479242 |
atatacagtcttatatacaattatatctagagttctttaacttaatttaaagctttaaacaaag |
33479305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University