View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15444_low_16 (Length: 228)
Name: NF15444_low_16
Description: NF15444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15444_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 6574609 - 6574799
Alignment:
| Q |
17 |
cacctcgcatcacctaagatcaaaactcgacgtccttaggagatcagacagggagtatttgaattccaagacaaaaagaattactacatacctgggtgaa |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6574609 |
caccccgcatcacctaagatcaaaactcgacgtccttaggagatcagatagggagtatttgaattccaagacaaaaagaattactacatacctgggtgaa |
6574708 |
T |
|
| Q |
117 |
ctgtggacctgattgggataatgacacagctaaatctccacaaacaggagagcctaaagcaaggatgtcgagagatcttggtgttacgcgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6574709 |
ctgtggacctgattgggataatgacacagctaaatctccacaaacaggagagcctaaagcaaggatgtcgagagatcttggtgttacgcgc |
6574799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 105 - 202
Target Start/End: Complemental strand, 34248723 - 34248626
Alignment:
| Q |
105 |
tacctgggtgaactgtggacctgattgggataatgacacagctaaatctccacaaacaggagagcctaaagcaaggatgtcgagagatcttggtgtta |
202 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||| || |||||||||||||||||||| ||||| ||| ||||||||||| ||||| |||||||||| |
|
|
| T |
34248723 |
tacctgcgtgaactgcggacctgattgtgataaagagacagctaaatctccacaaaccggagatccttttgcaaggatgtctagagaccttggtgtta |
34248626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University