View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15445_high_8 (Length: 253)
Name: NF15445_high_8
Description: NF15445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15445_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 34377366 - 34377140
Alignment:
| Q |
10 |
ataattctcatgacaatgcacaattttcgtgtgttaagggataaagaaagcaaacacaaacacaacaaaaatacaaatatcaacnnnnnnnngggc-ata |
108 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
34377366 |
ataattctcatgacaatgcacaatttttgtgtgttgagggataaagaaagcaaacacaaacacaacaaaaatacaaatatcaacttttttttgggcaata |
34377267 |
T |
|
| Q |
109 |
ttaaaattaaatgtttaatttatatatac---------aaacatcttttacgcatgcgtttaataatgagctgtcactggcttatgtcattattttgtga |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
34377266 |
ttaaaattaaatggttaatttatatataccgtcaatgtaaacatctattacgcatgcgtttaataatgagttgtcaccgacttatgtcattattttgtga |
34377167 |
T |
|
| Q |
200 |
accaaattttaatcttgtatgcataat |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
34377166 |
accaacttttaatcttgtatgcataat |
34377140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University