View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15445_low_10 (Length: 302)
Name: NF15445_low_10
Description: NF15445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15445_low_10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 302
Target Start/End: Complemental strand, 7934946 - 7934657
Alignment:
| Q |
14 |
caaaggggagggtatcagtgtggacaattatgc-aaggccattgcatttatataatggatgtacataagacacaacaatgaaaaataagataatgatgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934946 |
caaaggggagggtatcagtgtggacaattatgtgaaggccattgcatttatataatggatgtacataagacacaacaatgaaaaataagataatgatgaa |
7934847 |
T |
 |
| Q |
113 |
acatttgtttgtaatggagataaacattgttcccaacaaagcaaactatgcaaaacattggccttaacttttggttaaatattaattcatataatcatca |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934846 |
acatttgtttgtaatggagacaaacattgttcccaacaaagcaaactatgcaaaacattggccttaacttttggttaaatattaattcatataatcatcc |
7934747 |
T |
 |
| Q |
213 |
taggtagtcactaaatggtatcttatgaccaattattattttttaatctaaaatctgaatcttatcgagaaacaaagaactcgtctatgg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934746 |
taggtagtcactaaatggtatcttatgaccaattattattttttaatctaaaatctgaatcttatcgagaaacaaagaactcgtctatgg |
7934657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University