View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15445_low_9 (Length: 308)
Name: NF15445_low_9
Description: NF15445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15445_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 16 - 140
Target Start/End: Original strand, 41340762 - 41340886
Alignment:
| Q |
16 |
gcagagagtacaaagcatcggtttctcttggagtggaagacactataatcggataaccttgccccattctttttataacctacagaaagttgagaaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41340762 |
gcagagagtacaaagcatcggtttctcttggagtcgaagacactataatcggataaccttgccccattctttttataacctacagaaagttgagaaaatt |
41340861 |
T |
 |
| Q |
116 |
aagccgtaactattaactcgatatc |
140 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41340862 |
aagccgtaactattaactcgatatc |
41340886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 169 - 293
Target Start/End: Complemental strand, 41340886 - 41340762
Alignment:
| Q |
169 |
gatatcgagttaatagttacggcttaattttctcaactttctgtaggttataaaaagaatggggcaaggttatccgattatagtgtcttccactccaaga |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41340886 |
gatatcgagttaatagttacggcttaattttctcaactttctgtaggttataaaaagaatggggcaaggttatccgattatagtgtcttcgactccaaga |
41340787 |
T |
 |
| Q |
269 |
gaaaccgatgctttgtactctctgc |
293 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41340786 |
gaaaccgatgctttgtactctctgc |
41340762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University