View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15447_low_13 (Length: 244)
Name: NF15447_low_13
Description: NF15447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15447_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 37662690 - 37662469
Alignment:
| Q |
4 |
ggaggagcagagattgtagcagaaccataaccaaaacttgatgaatctttcagaatcccttcaagaacagaatgcaatgcagttgaaaatgaagaatacc |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662690 |
ggaggagcaaagattgtagcagaaccataaccaaaacttgatgaatctttcagaatcccttcgagaacagaatgcaatgcagttgaaaatgaagaatacc |
37662591 |
T |
|
| Q |
104 |
cttttgaaccaagtaactgaacaaccttgttccattcaacaaagttcttgaaatcaccaacttcatatgttgaatttgtcttgaatgaaggacaagttgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37662590 |
cttttgaaccaagtaactgaacaaccttgttccattcaacaaagttcttgaaatcaccaacttcatatgttgaattggttttgaatgaaggacaagttgg |
37662491 |
T |
|
| Q |
204 |
tgaacgaatgaaatcagaacca |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37662490 |
tgaacgaatgaaatcagaacca |
37662469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University