View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15448_high_15 (Length: 223)
Name: NF15448_high_15
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15448_high_15 |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
| [»] scaffold0087 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 5884327 - 5884526
Alignment:
| Q |
1 |
catgaatgattggatccatgtcactctagcagtttttatgaagaggttgnnnnnnn-tatttcaagtccaagactaacaggtaaatgcattattaatata |
99 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5884327 |
catgaatgattggatccatgtcacactggcagtttttatgaagaggttgaaaaaaaatatttcaagtccaagactaacaggtaaatgcattattaatata |
5884426 |
T |
 |
| Q |
100 |
ccttcaatatagtgtattattgcaaatgcatgcttgttgtttgaaaaagtaaatttccttataatttccgcacacatagttgaaatgattgtatttttta |
199 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5884427 |
ccttctatatagtgtatcattacaaatgcatgcttgttgtttgaaaaagtaaatttccttataatttccgcacacatagttgaaatgattgtatttttta |
5884526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5886224 - 5886272
Alignment:
| Q |
1 |
catgaatgattggatccatgtcactctagcagtttttatgaagaggttg |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | |||| |||||| |
|
|
| T |
5886224 |
catgaatgattggatccatgtcacactagcagtttctgtgaataggttg |
5886272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 5831228 - 5831264
Alignment:
| Q |
1 |
catgaatgattggatccatgtcactctagcagttttt |
37 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
5831228 |
catgaaagattggatctatgtcactctagcagttttt |
5831264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 5854169 - 5854205
Alignment:
| Q |
1 |
catgaatgattggatccatgtcactctagcagttttt |
37 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
5854169 |
catgaatgattggatccatatcacactagcagttttt |
5854205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 16735887 - 16735855
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
16735887 |
tattttttaggcttaattgcacttttggacccc |
16735855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 223
Target Start/End: Complemental strand, 156 - 123
Alignment:
| Q |
190 |
gtattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
156 |
gtattttttaggcttaattgcacttttggacccc |
123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 223
Target Start/End: Complemental strand, 29548503 - 29548470
Alignment:
| Q |
190 |
gtattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
29548503 |
gtattttttaggcttaattgcacttttggacccc |
29548470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 14578762 - 14578730
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
14578762 |
tattttttaggcttaattgcacttttggacccc |
14578730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 17262411 - 17262375
Alignment:
| Q |
187 |
attgtattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
17262411 |
attgtatttttttggcttaattgcacttttggacccc |
17262375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 24415064 - 24415096
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
24415064 |
tattttttaggcttaattgcacttttggacccc |
24415096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0087 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0087
Description:
Target: scaffold0087; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 35297 - 35333
Alignment:
| Q |
1 |
catgaatgattggatccatgtcactctagcagttttt |
37 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
35297 |
catgaaagattggatctatgtcactctagcagttttt |
35333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 238613 - 238645
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
238613 |
tattttttaggcttaattgcacttttggacccc |
238645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 19849865 - 19849833
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
19849865 |
tattttttaggcttaattgcacttttggacccc |
19849833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 44895970 - 44895938
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
44895970 |
tattttttaggcttaattgcacttttggacccc |
44895938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 45885271 - 45885239
Alignment:
| Q |
191 |
tattttttaggcttaattgcacttttagacccc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
45885271 |
tattttttaggcttaattgcacttttggacccc |
45885239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University