View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15448_low_16 (Length: 268)
Name: NF15448_low_16
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15448_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 4953490 - 4953391
Alignment:
| Q |
1 |
tggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatattaagtgataacattataggtatgtacccttttctctatcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4953490 |
tggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatattaagtgataacattataggtatgtacccttttctctaccatt |
4953391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 243
Target Start/End: Original strand, 3265977 - 3266025
Alignment:
| Q |
195 |
tgattggtttcaagaatgatgtggcatgtttgtgttccttagatttcaa |
243 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
3265977 |
tgattgatttcaagaatgatgtgaaatgttagtgtcccttagatttcaa |
3266025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University