View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15448_low_17 (Length: 256)
Name: NF15448_low_17
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15448_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 34 - 246
Target Start/End: Complemental strand, 36526009 - 36525797
Alignment:
| Q |
34 |
attgttttacttgtgttttactttgcacattaaagtacataccacaatttcattgttttattaataatatacaaataaaaacgtattctttggatttcaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36526009 |
attgttttacttgtgttttactttgcacattaaagtacataccacaatttcattgttttattaataatatacaaataaaaacgtattctttggatttcaa |
36525910 |
T |
 |
| Q |
134 |
tattaaaatatatagtataatgagatgaatttcaaaataatatctaaaaacttgactcactttcaccttgccttggctagcctaacgaagtggcttgttt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525909 |
tattaaaatatatagtataatgagatgaatttcaaaataatatctaaaaacttgactcactttcaccttgccttggctagcctaacgaagtggcttgttt |
36525810 |
T |
 |
| Q |
234 |
ttcagtttctctg |
246 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36525809 |
ttcagtttctctg |
36525797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University