View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15448_low_19 (Length: 253)
Name: NF15448_low_19
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15448_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 29295359 - 29295129
Alignment:
| Q |
9 |
gagatgaaagatgcgagcgaggagttaaggtctgcagctgttactgttattaaggagcttgatgaagcgaattcggatgggatggagagtgtggtaaaga |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295359 |
gagatggaagatgcgagcgaggagttaaggtctgcagctgttactgttattaaggagcttgatgaagcgaattcggatgggatggagagtgtggtaaaga |
29295260 |
T |
 |
| Q |
109 |
aattttctccggaggaagtgaagagagtattttctgttattatagctatgatgtcacatgttgtggatgatcctgtttggtatgatgttgatgataagaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295259 |
aattttctccggaggaagtgaagagagtattttctgttattatagatatgatgtcacatgttgtggatgatcctgtttggtatgatgttgatgataagaa |
29295160 |
T |
 |
| Q |
209 |
ttgtaaagatgttcggatgatagaggattat |
239 |
Q |
| |
|
||||||||||||| || |||||||||||||| |
|
|
| T |
29295159 |
ttgtaaagatgttgggttgatagaggattat |
29295129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 29321450 - 29321411
Alignment:
| Q |
174 |
gatgatcctgtttggtatgatgttgatgataagaattgta |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29321450 |
gatgatcctctttggtatgatgttgatgataagaattgta |
29321411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 29332641 - 29332602
Alignment:
| Q |
174 |
gatgatcctgtttggtatgatgttgatgataagaattgta |
213 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
29332641 |
gatgatcctctttggtatgatgtggatgataagaattgta |
29332602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University