View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15448_low_26 (Length: 201)
Name: NF15448_low_26
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15448_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 19 - 180
Target Start/End: Original strand, 42888064 - 42888225
Alignment:
| Q |
19 |
cacagaatatcgtatctcctagcggctatagaatctatatgtatatcacgtattgagatgaagtttgcatgataaaatgtgcatatgatttgccagaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42888064 |
cacagaatatcgtatctcctagcggctatagaatctatatgtatatcacgtattgagatgaagtttgcatgataaaatgtgcatatgatttgccagaaag |
42888163 |
T |
 |
| Q |
119 |
nnnnnnnntccttttcctttttatagtatcaatatatatactgatttttccactgacggttt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42888164 |
aaaaaaaatccttttcctttttatagtatcaatatatatactgatttttccactgacggttt |
42888225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University