View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15448_low_7 (Length: 428)
Name: NF15448_low_7
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15448_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 22 - 407
Target Start/End: Original strand, 23918172 - 23918557
Alignment:
| Q |
22 |
agaaaggttcttgcagctaccatgaatagtttagcttcgccggagaaggatgatggaagctgctctttcacattctaccttcttgatgaaattaagnnnn |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23918172 |
agaaaggttcttgcagctaccatgaatagtttagcttcaccggagaaggatgatggaagctgctatttcacattctaccttcttgatgaaattaagaaaa |
23918271 |
T |
|
| Q |
122 |
nnngcggtagatggacgagtcactggagcaaagaaaagaactgtggatatgcctataatattgctggtcatatgaaaatttctagctcaaaaatcactga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918272 |
aaagcggtagatggacgagtcactggagcaaagaaaagaactgtggatatgcctataatattgctggtcatatgaaaatttctagctcaaaaatcactga |
23918371 |
T |
|
| Q |
222 |
atcaaaagacgagaacttcaagggacagtgtctggtgaaagattatgtcctatttggcattggaatcgatcagccggatcaacgaccgcaagaattcgtc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918372 |
atcaaaagacgagaacttcaagggacagtgtctggtgaaagattatgtcctatttggcattggaatcgatcagccggatcaacgaccgcaagaattcgtc |
23918471 |
T |
|
| Q |
322 |
aagagaaaggagctggctgctgctgttattgagatcccttgtgaaaatgatgttaacttgccgaagaaggaatgcttaaagtgtct |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918472 |
aagagaaaggagctggctgctgctgttattgagatcccttgtgaaaatgatgttaacttgccgaagaaggaatgcttaaagtgtct |
23918557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University