View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_high_32 (Length: 295)
Name: NF15449_high_32
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 44 - 258
Target Start/End: Original strand, 33557578 - 33557799
Alignment:
| Q |
44 |
agacatagtataatttaattcttgatagtacatagtagtttttt-gtccttatcatgaactctccttttccttgataagatagcactttctatgttaaat |
142 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33557578 |
agacttagtataatttaattcttgccggtacatagtaatttttttgtccttatcacaaactctccttttccttgataagatagaactttctatgttaaat |
33557677 |
T |
 |
| Q |
143 |
tgagcaatattc--------cccgtgtctgtgatattatagctaattatcttcatgatgattttgatttttcacctaacacctacctcctacattctcct |
234 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33557678 |
tgagcaatattcaacaggaccccgtgcctgtgatattatagctaattatcttcatgatgattttgatttttcacctaacacctacctcctaca--ctcct |
33557775 |
T |
 |
| Q |
235 |
tcaatgggaaccaccttctccccc |
258 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
33557776 |
tcaatggaaaccaccttctccccc |
33557799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University