View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_high_45 (Length: 254)
Name: NF15449_high_45
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 33902057 - 33902305
Alignment:
| Q |
1 |
tgtaggttttgtacattgtcaagtcaaccttacgaaggtaaggtgctccatccatggaaaccttaacaaaagcagcagcagtagtgttacttgttgtctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33902057 |
tgtaggttttgtacattgtcaagtcaaccttacgaaggtaaggtgctccatccatggaaaccttaacaaaagcagcagcagtagtgttacttgttgtctt |
33902156 |
T |
 |
| Q |
101 |
ctcagtgtcctcagtattgttaaccttttgtgccatcatgttcttcctgtatgacctcactggtggccaaccaactacttgagccctgaaatattattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33902157 |
ctcagtgtcctcagtattgttaaccttttgtgccatcatgttcttcctgtatgacctcactggtggccaaccaactacttgagccctgaaatattattaa |
33902256 |
T |
 |
| Q |
201 |
tataatattcatttcaaatccctatataaatctcaattattcttctctctc |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
33902257 |
tataatattcatttcaaatccc--tataaatctcaattattcttttctctc |
33902305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 38529358 - 38529313
Alignment:
| Q |
10 |
tgtacattgtcaagtcaaccttacgaaggtaaggtgctccatccat |
55 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38529358 |
tgtacatcttcaagtcaaccttacgaaggtaaggagctccatccat |
38529313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University