View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_high_47 (Length: 251)
Name: NF15449_high_47
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_high_47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 37292655 - 37292421
Alignment:
| Q |
10 |
ataatactaacaaacggtttcatacatctttcccaagactgaatcnnnnnnnatcaaaaggctttgagttattttctcatggttcatacaacggtttgga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37292655 |
ataatactaacaaacggtttcatacatctttcccaagactgaatctttttttatcaaaag-ctttgagttattttctcatggttcatacaacggtttgga |
37292557 |
T |
 |
| Q |
110 |
nnnnnnnnnnnngaaagtgttgttattgcttgaggcccaagtaatggcgacagagccagagccagagccaactttgccattctcaattgtatctgttgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37292556 |
tttttgttttttgaaagtgttgttattgcttgaggcccaagtaatggcgacagagccagagcca------actttgccattctcaattgtatctgttgtt |
37292463 |
T |
 |
| Q |
210 |
gaagatgttcttcaaaaacatggaggccgattaagcgacatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37292462 |
gaagatgttcttcaaaaacatggaggccgattaagcgacatc |
37292421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University