View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_high_58 (Length: 240)
Name: NF15449_high_58
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_high_58 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 35112320 - 35112542
Alignment:
| Q |
18 |
cgtgttattggtacgaagtatccaccggctttgccgatgagtactactgctatgtttacaaactggacttcttttttaaactctgatcttgatgtatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35112320 |
cgtgttattggtacgaagtatccaccggctttgccgatgagtactactgctatgtttacaaactggacttcttttttaaactctgatcttgatgtatttg |
35112419 |
T |
 |
| Q |
118 |
cttttatatcattcttcctgtcttgttcaacatacaggatgtcagaatctccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35112420 |
cttttatatcattcttcctgtcttgttcaacatacaggatgtcagaatctccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttag |
35112519 |
T |
 |
| Q |
218 |
attttggaatttgaagttatatc |
240 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
35112520 |
attttggaatttgaagttgtatc |
35112542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 167 - 220
Target Start/End: Complemental strand, 38117897 - 38117844
Alignment:
| Q |
167 |
tccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttagatt |
220 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
38117897 |
tccatttcaaattgggccaatccttctcgtaaatgatcccttcacggttagatt |
38117844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 218
Target Start/End: Complemental strand, 38127710 - 38127659
Alignment:
| Q |
167 |
tccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttaga |
218 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
38127710 |
tccatttcaaattgggccaatccttctcgtaaatgatcccttcacggttaga |
38127659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University