View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_high_60 (Length: 236)
Name: NF15449_high_60
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 24939958 - 24940163
Alignment:
| Q |
18 |
tctgtcttattgctgtgttttttagctcatccagacttattagctttagtcaattacatatactcaataaatgactagattgtcacataccaaagacaaa |
117 |
Q |
| |
|
||||||||||||| || ||||||||||||| | ||| ||||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24939958 |
tctgtcttattgcggtattttttagctcatactgacatattagcttcaatcaattacatatactcaataattgactagattgtcacataccaaagacaaa |
24940057 |
T |
|
| Q |
118 |
cattttggccactttaatttactcacattatttatgggcattttgctgtttcatgctatt-tattatattagatattgtaagtttgagcatatattcacc |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||| |||||||| ||||||||| | |||||||| |
|
|
| T |
24940058 |
cattgtggccactttaatttactcacattatttataggtattttgctgtttcatgctattaaattatattggatattgtgagtttgagcgtgtattcacc |
24940157 |
T |
|
| Q |
217 |
attttt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
24940158 |
attttt |
24940163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University