View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_high_65 (Length: 223)
Name: NF15449_high_65
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 4 - 215
Target Start/End: Complemental strand, 32359095 - 32358885
Alignment:
| Q |
4 |
aaacagaccctttgtttcattgctcgagnnnnnnnngtttcagtttgagtggacatctatgtgatattggtattaatgattgctatatcttgtctaannn |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32359095 |
aaacagaccctttgtttcattgctcgagttttttttgtttcagtttgagtggacatctatgtgatattggtattaatgattgctatatcttgtctaattt |
32358996 |
T |
 |
| Q |
104 |
nnnnnncccgagttatctgatattctgaaatttggtagtatgcttagttctgtgtattttatacaatattaaatgtgtataggattcttactagagttgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32358995 |
ttttt-cccgagttatctgatattctgaaatttggtagtatgcttagttctgtgtattttatacgatattaaatgtgtataggattcttactagagttgt |
32358897 |
T |
 |
| Q |
204 |
attcattcatct |
215 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32358896 |
attcattcatct |
32358885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University