View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_38 (Length: 295)
Name: NF15449_low_38
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 124 - 238
Target Start/End: Original strand, 8112545 - 8112659
Alignment:
| Q |
124 |
gagtgtggaggggtacaagcaggtagaactagggttaccaagaatacaagaattgaaggaagggaaatatttgttttcttttctttttctatgtaacttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8112545 |
gagtgtggaggggtacaagcaggtagaactagggttaccaagaatacaagaattgaaggaagggaaatatttgttttcttttctttttctatgtaacttg |
8112644 |
T |
|
| Q |
224 |
aaaatcttgattgta |
238 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
8112645 |
aaaattttgattgta |
8112659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 57
Target Start/End: Original strand, 8112430 - 8112473
Alignment:
| Q |
14 |
aagaatatcggttaattcttttgatggattttttatttatcaac |
57 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8112430 |
aagaaaatcggttaacttttttgatggattttttatttatcaac |
8112473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University