View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_42 (Length: 285)
Name: NF15449_low_42
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 42 - 273
Target Start/End: Original strand, 38813993 - 38814224
Alignment:
| Q |
42 |
gcagctaattcagcttcaatattgaaaatcaaaataaagatgaatgaactgaaacatcaaaaaacaaaggcttctaactattcaaacttagactgctaaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38813993 |
gcagctaattcagcttcaatattgaaaatcaaaataaagatgaatgaactgaaacatcaaaaaacaaaggcttctaactattcaaacttggactgctaaa |
38814092 |
T |
 |
| Q |
142 |
gttgtgcttaccagaacatatgtatccttttgaagatcaaatttcgaatttatttcaggcccccaggttccaaattgtcgaaggggaagaactgtaaatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814093 |
gttgtgcttaccagaacatatgtatccttttgaagatcaaatttcgaatttatttcaggcccccaggttccaaattgtcgaaggggaagaactgtaaatc |
38814192 |
T |
 |
| Q |
242 |
ctggcaaagatgcggtggtcctgtggatgatg |
273 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
38814193 |
ctggcaaagatgcggtggtcctgtgtatgatg |
38814224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 251
Target Start/End: Original strand, 38820573 - 38820703
Alignment:
| Q |
121 |
attcaaacttagactgctaaagttgtgcttaccagaacatatgtatccttttgaagatcaaatttcgaatttatttcaggcccccaggttccaaattgtc |
220 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||||| ||||||||||||| |||||||||||| ||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
38820573 |
attcaaacttggactgctaaagctgtacttacaagaacatatgtattcttttgaagatccaatttggtgtttatttcaggcacccaggttccaaattgaa |
38820672 |
T |
 |
| Q |
221 |
gaaggggaagaactgtaaatcctggcaaaga |
251 |
Q |
| |
|
| ||||||||||| |||||||||||||||| |
|
|
| T |
38820673 |
ggaggggaagaaccataaatcctggcaaaga |
38820703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University