View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_51 (Length: 253)
Name: NF15449_low_51
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 2 - 235
Target Start/End: Original strand, 42217973 - 42218206
Alignment:
| Q |
2 |
cctagaagattgtggaagctgaaacaagaatctactagggatatgatatgtggaatttgggcatacaaactaagattcctaaattgcatccctatctttc |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217973 |
cctagaagattgtggaagctaaaacaagaatctcctagggatatgatatgtgtaatttgggcatacaaactaagattcctaaattgcatccctatctttc |
42218072 |
T |
 |
| Q |
102 |
tccctcacacacacagcctttgaattcaaacaatgaccacatggtcccatcccatgttcaattcctcacataccatgttccagctgaaagagactttcca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42218073 |
tccctcacacacacagcctttgaattcaaacaatgaccacatggtcccatcccatgttcaattcctcacataccatgttccagctgaaagagactttcca |
42218172 |
T |
 |
| Q |
202 |
gcgattggaaacctccttcagaagcacagatact |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42218173 |
gcgattggaaacctccttcagaagcacagatact |
42218206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University