View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15449_low_57 (Length: 248)

Name: NF15449_low_57
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15449_low_57
NF15449_low_57
[»] chr4 (1 HSPs)
chr4 (1-161)||(47583024-47583189)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 47583189 - 47583024
Alignment:
1 tctatctctgtctctctgcttcatgtcgtgtcacaattcacaaacctgttacattacatttcatgggat-----actcaattggtttcgtgtgcccgtgt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||    
47583189 tctatctctgtctctctgcttcatgtcgtgtcacaattcacaaacctgttacattacatttcatgggatccgatactcaattggtttcgtgtgcccgtgt 47583090  T
96 tcaaaatttccactatttctctgaatcaatgctgtaaactataattggaatagctagcaatacggc 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47583089 tcaaaatttccactatttctctgaatcaatgctgtaaactataattggaatagctagcaatacggc 47583024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University