View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_57 (Length: 248)
Name: NF15449_low_57
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 47583189 - 47583024
Alignment:
| Q |
1 |
tctatctctgtctctctgcttcatgtcgtgtcacaattcacaaacctgttacattacatttcatgggat-----actcaattggtttcgtgtgcccgtgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47583189 |
tctatctctgtctctctgcttcatgtcgtgtcacaattcacaaacctgttacattacatttcatgggatccgatactcaattggtttcgtgtgcccgtgt |
47583090 |
T |
 |
| Q |
96 |
tcaaaatttccactatttctctgaatcaatgctgtaaactataattggaatagctagcaatacggc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583089 |
tcaaaatttccactatttctctgaatcaatgctgtaaactataattggaatagctagcaatacggc |
47583024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University