View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_64 (Length: 237)
Name: NF15449_low_64
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 130 - 221
Target Start/End: Original strand, 35254363 - 35254454
Alignment:
| Q |
130 |
tcatcactaacttttctaagcttcaattcaattcacaaaaatgaagatatcgttgcagaattattccaattccaaagcaggaacaataagag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254363 |
tcatcactaacttttctaagcttcaattcaattcacaaaaatgaagatatcgttgcagaattattccaattccaaagcaggaacaataagag |
35254454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 13 - 101
Target Start/End: Original strand, 35254246 - 35254334
Alignment:
| Q |
13 |
aaaataagagtaattaactaacggtggagtgacgttgaagtagagagttgagaggttagttggaaatgtaaattgaagcaattcagtac |
101 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254246 |
aaaataagagcaattaactaacggtggagtgacgttgaagtagagagttgagaggttagttggaaatgtaaattgaagcaattcagtac |
35254334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University