View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15449_low_67 (Length: 227)

Name: NF15449_low_67
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15449_low_67
NF15449_low_67
[»] chr4 (1 HSPs)
chr4 (7-227)||(984153-984373)
[»] chr2 (1 HSPs)
chr2 (13-144)||(45322359-45322490)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 984373 - 984153
Alignment:
7 gtaagctggtaggatgtggttcagctgtgccaactcttgagattactaatgacgagcttgcaaaaatagttgatacttctgatgaatggataaatgttcg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
984373 gtaagctggtaggatgtggttcagctgtgccaactcttgagattactaatgacgagcttgcaaaaatagttgatacttctgatgaatggataaatgttcg 984274  T
107 caccgggattcgtaaacgccgagttctttcaggttagtttatttctaacttgctatgtaaccatcattaatagaatggttgcagctgaattgaatttggc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
984273 caccgggattcgtaaacgccgagttctttcaggttagtttatttctaacttgctatgtaaccatcattaatagaatggttgcagctgaattgaatttggc 984174  T
207 ttttatggagtgttgatagtt 227  Q
    |||||||||||||||||||||    
984173 ttttatggagtgttgatagtt 984153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 144
Target Start/End: Complemental strand, 45322490 - 45322359
Alignment:
13 tggtaggatgtggttcagctgtgccaactcttgagattactaatgacgagcttgcaaaaatagttgatacttctgatgaatggataaatgttcgcaccgg 112  Q
    |||| ||||||||||| ||| ||||| ||||| ||||||||||||| || ||| | ||| | |||||||||  ||||||||||||| ||| |||||| ||    
45322490 tggttggatgtggttctgctttgccatctcttcagattactaatgaagatctttccaaagttgttgatactagtgatgaatggatatatgctcgcacagg 45322391  T
113 gattcgtaaacgccgagttctttcaggttagt 144  Q
    |||||| || || || ||||||||||||||||    
45322390 gattcggaagcggcgtgttctttcaggttagt 45322359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University