View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_68 (Length: 227)
Name: NF15449_low_68
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 39 - 209
Target Start/End: Original strand, 6411635 - 6411805
Alignment:
| Q |
39 |
taagctcaatatcaatatataataggctatgggcttaaatttgaacagcacgattcagtgaactgatcaaaataatttgccgaagtctgtaattttttaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6411635 |
taagctcaatatcaatatataataggctatgggcttaaatttgaacagcacgattcagtgaactgatcaaaataatttgccgaagtctgtaattttttaa |
6411734 |
T |
 |
| Q |
139 |
gatgggtggcaaataagaaacaagaagtatgtaaaactggatattttaaacctggttttgtacatattcgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6411735 |
gatgggtggcaaataagaaacaagaagtatgtaaaactggatattttaaacctggttttgtacatattcgt |
6411805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 6408489 - 6408529
Alignment:
| Q |
46 |
aatatcaatatataataggctatgggcttaaatttgaacag |
86 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6408489 |
aatatcgatatataataggctatgggcttaaattggaacag |
6408529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University