View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15449_low_73 (Length: 207)
Name: NF15449_low_73
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15449_low_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 12855855 - 12856045
Alignment:
| Q |
1 |
tagattttctctctctcaaattttctcttgttttgcaggtttttgatacgtaatgccgccaaagcgaggggtttccttcgctaagaacggaagcaaagga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12855855 |
tagattttctctctctcaatttttctcttgttttgcaggtttttgatacgtaatgccgccaaagcgaggggtttccttcgctaagagcggaagcaaagga |
12855954 |
T |
 |
| Q |
101 |
attcgttttcctattttgagtttcgttcttctatgtgttcttacgccggttattttcttcttcggtcgaggttttcacgttactggttagt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12855955 |
attcgttttcctattttgagtttcgttcttctatgtgttcttacgccggttgttttcttcttcggtcgaggttttcacgttactggttagt |
12856045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University