View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1544_low_11 (Length: 235)
Name: NF1544_low_11
Description: NF1544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1544_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 31873196 - 31872976
Alignment:
| Q |
1 |
ttaattcaattcctctcgaagcctcttcaattttctatcccttttcatgtgtcacatttctattatcctaaactataccaattaatggagagtagtgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31873196 |
ttaattcaattcctctcgaagcctctttaattttctatcccttttcatgtgtcacatttctattatcctaaactataccaattaatggagagtagtgcaa |
31873097 |
T |
|
| Q |
101 |
gctctgaactccctcctggctttagatttcatccaactgatgaggaactaattgtgcattacctttgtaatcaagctacatcaaagccatgccctgcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31873096 |
gctctgaactccctcctggctttagatttcatccaactgatgaggaactaattgtgcattacctttgtaatcaagctacatcaaagccatgccctgcatc |
31872997 |
T |
|
| Q |
201 |
tatcataccagaagttgatat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31872996 |
tatcataccagaagttgatat |
31872976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 106 - 221
Target Start/End: Complemental strand, 18429187 - 18429072
Alignment:
| Q |
106 |
gaactccctcctggctttagatttcatccaactgatgaggaactaattgtgcattacctttgtaatcaagctacatcaaagccatgccctgcatctatca |
205 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| ||||||||| |||| |||||||||||||| |||||| | ||||| ||||||||||||| |
|
|
| T |
18429187 |
gaactcccacctggctttaggtttcatccaactgatgaggagctaattgtgtattatctttgtaatcaagcaacatcacaaccatgtcctgcatctatca |
18429088 |
T |
|
| Q |
206 |
taccagaagttgatat |
221 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
18429087 |
ttccagaagttgatat |
18429072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University