View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1544_low_9 (Length: 239)
Name: NF1544_low_9
Description: NF1544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1544_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 40 - 220
Target Start/End: Complemental strand, 13109659 - 13109474
Alignment:
| Q |
40 |
cgagagacaagataaaattggttgaactttattatcaaatattgnnnnnnnnnat-----gtttatttgtgtgaatcggaacgttgttttaaccatttct |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13109659 |
cgagagacaagataaaattggttgaactttattatcaaatattgtgttttttttttttttgtttatttgtgtgaatcggatcgttgttttaaccatttct |
13109560 |
T |
|
| Q |
135 |
tataataacatgaatgatcatgctctaaccttactagctagcacataaatttaattcaaagtcatttgtggaaaacatacaactat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13109559 |
tataataacatgaatgatcatgctctaaccttactagctagcacataaatttaattcaaagtcatttgtggaaaacatacaactat |
13109474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University