View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15450_low_4 (Length: 293)
Name: NF15450_low_4
Description: NF15450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15450_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 21 - 282
Target Start/End: Complemental strand, 15809104 - 15808852
Alignment:
| Q |
21 |
ctgtctgtgtctcatctttatgcctgaaaaagtctgagttgagattcattggccaacctagcttaaaacatttgtcagacctggaaaaaggacagatttg |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15809104 |
ctgtctgtgtttcatctttatgcctgaaaaagtctgagttgagattcattggccaaccaagcttaaaacatttgtcagacctggaaaaaggacagacttg |
15809005 |
T |
|
| Q |
121 |
agcttattggtatccaaagaacctaaaaacagtttcttgcaatgctttgactattttattatatgatatataattaaaatatcagtgaaagatttaccaa |
220 |
Q |
| |
|
|||||||||||||||| |||||| || ||||||||||||| |||||||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
15809004 |
agcttattggtatccagagaacc---------attgatgcaatgctttgagtattttattatatgatatataacttaaatatcagtggaagatttaccaa |
15808914 |
T |
|
| Q |
221 |
aaatattcattaagatcatcatagtttctccagttggaatgactcgccttgcctttgctact |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15808913 |
aaatattcattaagatcatcatagtttctccagttggaatgactcgccttgcctttgttact |
15808852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University