View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15452_low_13 (Length: 224)
Name: NF15452_low_13
Description: NF15452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15452_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 42 - 207
Target Start/End: Complemental strand, 408801 - 408636
Alignment:
| Q |
42 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgggaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408801 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgagaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
408702 |
T |
 |
| Q |
142 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408701 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctctt |
408636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 412910 - 412871
Alignment:
| Q |
1 |
ttatagaacaagggtttgtatacaaacatcttaaatttag |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
412910 |
ttatagaacaagggtttgtatacaaacatcttaaatttag |
412871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University