View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_high_21 (Length: 236)
Name: NF15453_high_21
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 29 - 145
Target Start/End: Original strand, 36055150 - 36055266
Alignment:
| Q |
29 |
ttttattttattttggcttcacatattattagactgaaatataaacaagttaattttgcttacagttactacaaccggtgcagtcaaccgcttctttgta |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36055150 |
ttttattttattttggcttcacatattattagattgaaatctaaacaagttaattttgcttaccgttactacgaccggtgcagtcaaccgcttctttgta |
36055249 |
T |
 |
| Q |
129 |
tttgtgttatggtgtaa |
145 |
Q |
| |
|
| |||||| ||||||| |
|
|
| T |
36055250 |
tcggtgttagggtgtaa |
36055266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 219
Target Start/End: Original strand, 36055299 - 36055340
Alignment:
| Q |
178 |
agcaccttgtctctgtatatatttgcggtgctcctccttttg |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36055299 |
agcaccttgtctctatatatatttgcggtgctcctccttttg |
36055340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University