View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_high_22 (Length: 229)
Name: NF15453_high_22
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 28489727 - 28489926
Alignment:
| Q |
10 |
tgtactactattcaatttcttgaacttctaaagtccatccttgtcaacacaactaatatttttggaagcacatgttagcaacaagagatactatgaagca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28489727 |
tgtactactattcaatttcttgaacttctaaagtccatccttgtcaacacaaattatattttttgaagcacatgttagcaacaagagatactatgaagca |
28489826 |
T |
 |
| Q |
110 |
ttctaaaacaaagaaaatagaatacagggaaaattattattgtgaaactagggagtagggactaagaagttcaaacttcaaagagattgccagccccctt |
209 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28489827 |
ttgtaaaacaaagaaaatagaatacagggaaaattattattgtgaaactagggagtagggactaagaagttcaaacatcaaagagattgccagccccctt |
28489926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University