View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_high_24 (Length: 216)
Name: NF15453_high_24
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 33 - 196
Target Start/End: Original strand, 49810102 - 49810265
Alignment:
| Q |
33 |
tttctttatcaaagtaacgccaattaattcttcatcttagcaacgagagcaagaaacgccgtaaacttctacttttagaaggtgacattttataaattat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49810102 |
tttctttatcaaagtaacgccaattaattcttcatcttagcaacgagagcaagaaatgccgtaaacttctacttttagaaggtgacattttataaattat |
49810201 |
T |
 |
| Q |
133 |
tttacgccgaaaatcattttatattatcggtctgcacaaaattgcttaaatttttaggggaact |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49810202 |
tttacgccgaaaatcattttatattatcggtctacacaaaattgcttaaatttttaggggaact |
49810265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University