View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_low_15 (Length: 353)
Name: NF15453_low_15
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 27027711 - 27027375
Alignment:
| Q |
1 |
tccagtttgattcagaggagtctgcaaatgtggctatccagaaaatgaatggctctactgtgagagataagcagatgtatgtgaaattattttagcgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27027711 |
tccagtttgattcagaggagtctgcaaatgtggctatccagaaaatgaatggctctactgtgagagataagcagatgtatgtgaaattattttagcgctt |
27027612 |
T |
|
| Q |
101 |
gttaaaatttgccgtcattgatatccatatatgttgtgatttgaagtctatgnnnnnnnngccttcagttaattgctgtttttgttatcctaagattggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27027611 |
gttaaaatttgccgtcattgatatccatatatgttgtgatttgaagtctatgttttttttgccttcagttaattgctgtttttgttatcctaagattggt |
27027512 |
T |
|
| Q |
201 |
tttaatctgattccaattcttctcacagatatgttgggaaatttatcagaaaaagtgagcgctctcttcctgacctggatgccaaatttacaaacttgta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27027511 |
tttaatctgattccaattcttctcacagatatgttgggaaatttatcagaaaaagtgagcgctctcttcctgacctggatgccaaatttacaaacttgta |
27027412 |
T |
|
| Q |
301 |
cgttaagaatttggacccagttgttactgagaagcat |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27027411 |
cgttaagaatttggacccagttgttactgaaaagcat |
27027375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 227
Target Start/End: Complemental strand, 17000046 - 17000004
Alignment:
| Q |
185 |
ttatcctaagattggttttaatctgattccaattcttctcaca |
227 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
17000046 |
ttatcctaagattcgttttaatctaattccaattcttctcaca |
17000004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University