View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_low_20 (Length: 268)
Name: NF15453_low_20
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 72 - 258
Target Start/End: Original strand, 52809239 - 52809428
Alignment:
| Q |
72 |
ttgtggtgttaaaggttggtctttggatgccgacttaattataa---cttcagcagcatcatcatccaactcctcttggtcaccttgaacattgatactc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809239 |
ttgtggtgttaaaggttggtctttggatgccgacttaattataataacttgagcatcatcatcatccaactcctcttggtcaccttgaacattgatactc |
52809338 |
T |
 |
| Q |
169 |
ttgtaccacttagcacagaacaagtaaatcacaaaatcaaaaacaactagtcctgctagaagaaagaaaaacctatccatgtgccctttg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809339 |
ttgtaccacttagcacagaacaagtaaatcacaaaatcaaaaacaactagccctgctagaagaaagaaaaacctatccatgtgccctttg |
52809428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 52809205 - 52809239
Alignment:
| Q |
18 |
aaaaatagtatattttgttttttggatattattct |
52 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
52809205 |
aaaaatagtatattttgtttttgggatattattct |
52809239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University