View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_low_21 (Length: 267)
Name: NF15453_low_21
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 24991008 - 24991248
Alignment:
| Q |
17 |
catggatcaccaaagttgcttcccatccacccaatggagctctttgatggtcgcagaatcgaaggttcagtgttcggaggtttcaaaggcaaaagtcaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24991008 |
catggatcaccaaagttgcttcccatccacccaatggagctctttgatggtcgcagaatcgaaggttcagtgttcggaggtttcaaaggcaaaagtcaat |
24991107 |
T |
 |
| Q |
117 |
tgcctaatcttgccacagaatgcatgaaaggggtaaatgatcatcactacttgcaaaaactcaaattatgcgacgcgttttaatgtgcaaataattatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24991108 |
tgcctaatcttgccacagaatgcatgaaaggggtaaatgatcatcactacttgcaaaaactcaaattatgcgacgcattttaatgtgcaaataattatat |
24991207 |
T |
 |
| Q |
217 |
tcttctattatttttaggtgataaagctggataatttcatc |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
24991208 |
tcttctattatttttaggcgataaagttggataatttcatc |
24991248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 24994681 - 24994917
Alignment:
| Q |
17 |
catggatcaccaaagttgcttcccatccacccaatggagctctttgatggtcgcagaatcgaaggttcagtgttcggaggtttcaaaggcaaaagtcaat |
116 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||||||||| |||| ||||||||| || || || ||||||||||||||||||||||||| |
|
|
| T |
24994681 |
catgcatcaccaaagttacttcctctccacccaatggagctctttgatggccgcaaaatcgaaggatcggtctttggaggtttcaaaggcaaaagtcaat |
24994780 |
T |
 |
| Q |
117 |
tgcctaatcttgccacagaatgcatgaaaggggtaaatgatcatcactacttgcaaaaactcaaattatgcgacgcgttttaatgtgcaaataattatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||| ||| ||| ||||||||| |
|
|
| T |
24994781 |
tgcctaatcttgccacagaatgcatgaaaggggt-aatgatcatcacta---gcaaaaactcaaattatgcgatgcgttttagtgtccaagtaattatat |
24994876 |
T |
 |
| Q |
217 |
tcttctattatttttaggtgataaagctggataatttcatc |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
24994877 |
tcttctattatttttaggcgataaagttggatgatttcatc |
24994917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University