View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_low_23 (Length: 264)
Name: NF15453_low_23
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 22062350 - 22062275
Alignment:
| Q |
139 |
attttgctccagaattgcgttggatactgcaccttttttacatgcacatcttttagacttcgcatgttacacgggc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22062350 |
attttgctccagaattgcgttggatactgcaccttttttacatgcacatcttttagacttcgcatgttacacgggc |
22062275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 22062430 - 22062345
Alignment:
| Q |
1 |
tagttcattgaatttgcactattttcccccaatttccagggttttagagttccaagatcatgttcccaaaattttgtttgattttg |
86 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
22062430 |
tagttcattgaatttgcactatttccccctaatttccagggttttagagttccaagatcatgtttccaaatttttgtttgattttg |
22062345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 22061329 - 22061287
Alignment:
| Q |
206 |
tacacgggcaagttaaacaaacaaaaacagtagtcttagattt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
22061329 |
tacacgggcaagttaaacaaacaaaaacaatagtcctagattt |
22061287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University