View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15453_low_25 (Length: 254)

Name: NF15453_low_25
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15453_low_25
NF15453_low_25
[»] chr1 (1 HSPs)
chr1 (3-240)||(38504352-38504589)


Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 240
Target Start/End: Complemental strand, 38504589 - 38504352
Alignment:
3 caaaggaaatgatactggcgaagctacaaggaaacaatatgctgcaactgttaatgttatcaatggattggaagcgaatatttctaaactttcggattct 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38504589 caaaggaaatgatactggcgaagctacaaggaaacaatatgctgcaactgttaatgttatcaatggattggaagcgaatatttctaaactttcggattct 38504490  T
103 gaactaagggataagacttttgagctaagagaacgtgctcaaaagagagaatcgttggattctcttttgcctgtgagtataatctttgattcattttatt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38504489 gaactaagggataagacttttgagctaagagaacgtgctcaaaagagagaatccttggattctcttttgcctgtgagtataatctttgattcattttatt 38504390  T
203 gaatgaagtttaggaatttaatcacatgcaaaattatg 240  Q
    ||||||||||||||||||||||||||||||||||||||    
38504389 gaatgaagtttaggaatttaatcacatgcaaaattatg 38504352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University