View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15453_low_25 (Length: 254)
Name: NF15453_low_25
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15453_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 240
Target Start/End: Complemental strand, 38504589 - 38504352
Alignment:
| Q |
3 |
caaaggaaatgatactggcgaagctacaaggaaacaatatgctgcaactgttaatgttatcaatggattggaagcgaatatttctaaactttcggattct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38504589 |
caaaggaaatgatactggcgaagctacaaggaaacaatatgctgcaactgttaatgttatcaatggattggaagcgaatatttctaaactttcggattct |
38504490 |
T |
 |
| Q |
103 |
gaactaagggataagacttttgagctaagagaacgtgctcaaaagagagaatcgttggattctcttttgcctgtgagtataatctttgattcattttatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38504489 |
gaactaagggataagacttttgagctaagagaacgtgctcaaaagagagaatccttggattctcttttgcctgtgagtataatctttgattcattttatt |
38504390 |
T |
 |
| Q |
203 |
gaatgaagtttaggaatttaatcacatgcaaaattatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38504389 |
gaatgaagtttaggaatttaatcacatgcaaaattatg |
38504352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University