View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15454_high_24 (Length: 384)
Name: NF15454_high_24
Description: NF15454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15454_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 27763941 - 27763821
Alignment:
| Q |
104 |
taacataatttcaactgcgataatcaaagatcataatgcaaccctagatgtgagcgcgactgcgatttaaaaccttgtttat---atgtataaaatgtag |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||| || |
|
|
| T |
27763941 |
taacataatttcaactgcgacaatcaaagatcataatgcaaccctagatgtgagcacgactatgatttaaaaccttgtttatttgttgtataaaatttaa |
27763842 |
T |
 |
| Q |
201 |
tcttagtttgcttctttactt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27763841 |
tcttagtttgcttctttactt |
27763821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 27763802 - 27763748
Alignment:
| Q |
295 |
agcatatttgtgcatgttttggattcccacctcattgatggtcataaagagttaa |
349 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| |||||||| ||||| |
|
|
| T |
27763802 |
agcatatttgtgcatgttttggatccacacctcattgataatcataaagtgttaa |
27763748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University